Product Details

SNP ID: rs2071036
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:62852565 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTGGCTCCCAGTGTCTTAATCTGT[A/G]TCTGCTAACACTTTAAGGTACATCT
Phenotype: MIM: 158070 MIM: 603222 MIM: 603223 MIM: 603224 MIM: 603225 MIM: 603226 MIM: 603227 MIM: 603228 MIM: 603229 MIM: 603230
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: SLC3A2 PubMed Links

Gene Details

Gene: SLC3A2
Gene Name: solute carrier family 3 member 2

There are no transcripts associated with this gene.

Gene: SNHG1
Gene Name: small nucleolar RNA host gene 1

There are no transcripts associated with this gene.

Gene: SNORD22
Gene Name: small nucleolar RNA, C/D box 22

There are no transcripts associated with this gene.

Gene: SNORD25
Gene Name: small nucleolar RNA, C/D box 25

There are no transcripts associated with this gene.

Gene: SNORD26
Gene Name: small nucleolar RNA, C/D box 26

There are no transcripts associated with this gene.

Gene: SNORD27
Gene Name: small nucleolar RNA, C/D box 27

There are no transcripts associated with this gene.

Gene: SNORD28
Gene Name: small nucleolar RNA, C/D box 28

There are no transcripts associated with this gene.

Gene: SNORD29
Gene Name: small nucleolar RNA, C/D box 29

There are no transcripts associated with this gene.

Gene: SNORD30
Gene Name: small nucleolar RNA, C/D box 30

There are no transcripts associated with this gene.

Gene: SNORD31
Gene Name: small nucleolar RNA, C/D box 31

There are no transcripts associated with this gene.

View Full Product Details