Product Details
- SNP ID
-
rs2276321
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.4:88731287 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACAAGAGGGATGGGTGTGTGTGGTG[C/T]GGCGGGGGGGAAGGGAGGGTGGGGG
- Phenotype
-
MIM: 613299
MIM: 613300
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
FAM13A
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs537100016] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FAM13A
- Gene Name
- family with sequence similarity 13 member A
- Gene
- FAM13A-AS1
- Gene Name
- FAM13A antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details