Product Details
- SNP ID
-
rs2289704
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:26583351 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCATGCCCTGACTTGAGTTTGCAGG[C/G]CCGTCCTCGTGTTTGTCACTCCAGG
- Phenotype
-
MIM: 610646
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
C2orf70
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs77379382] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C2orf70
- Gene Name
- chromosome 2 open reading frame 70
There are no transcripts associated with this gene.
- Gene
- CIB4
- Gene Name
- calcium and integrin binding family member 4
View Full Product Details