Product Details

SNP ID

rs2122031

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.3:11272457 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TAAGTGAGCCGCGGCGGGCGAGGGT[A/G]TAGTGGGGTCTTGCTGGGCCGGTTT

Phenotype

MIM: 608760 MIM: 600167

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ATG7 PubMed Links

Additional Information

For this assay, SNP(s) [rs111373406] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ATG7

Gene Name

autophagy related 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001136031.2	35	Intron			NP_001129503.2
NM_001144912.1	35	Intron			NP_001138384.1
NM_006395.2	35	Intron			NP_006386.1
XM_006712931.3	35	Intron			XP_006712994.1
XM_006712932.3	35	Intron			XP_006712995.1
XM_006712933.3	35	UTR 5			XP_006712996.1
XM_011533277.2	35	Intron			XP_011531579.1
XM_011533278.2	35	Intron			XP_011531580.1
XM_011533279.2	35	Intron			XP_011531581.1
XM_011533280.2	35	Intron			XP_011531582.1
XM_011533281.2	35	Intron			XP_011531583.1
XM_011533282.2	35	Intron			XP_011531584.1
XM_011533283.2	35	Intron			XP_011531585.1
XM_011533284.2	35	Intron			XP_011531586.1
XM_011533285.2	35	Intron			XP_011531587.1
XM_011533286.2	35	Intron			XP_011531588.1
XM_017005542.1	35	Intron			XP_016861031.1
XM_017005543.1	35	Intron			XP_016861032.1
XM_017005544.1	35	Intron			XP_016861033.1
XM_017005545.1	35	Intron			XP_016861034.1
XM_017005546.1	35	Intron			XP_016861035.1
XM_017005547.1	35	Intron			XP_016861036.1
XM_017005548.1	35	Intron			XP_016861037.1
XM_017005549.1	35	Intron			XP_016861038.1
XM_017005550.1	35	Intron			XP_016861039.1
XM_017005551.1	35	Intron			XP_016861040.1
XM_017005552.1	35	Intron			XP_016861041.1
XM_017005553.1	35	Intron			XP_016861042.1
XM_017005554.1	35	Intron			XP_016861043.1

Gene

HRH1

Gene Name

histamine receptor H1

There are no transcripts associated with this gene.

View Full Product Details