Product Details
- SNP ID
-
rs2691258
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:51014030 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGTTCAGTGGCCTCATGAAGGCAGA[A/G]AAGGTGCTAATGACTCAGGGCCAGC
- Phenotype
-
MIM: 602673
MIM: 604434
MIM: 605504
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
KLK10
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs11275641] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KLK10
- Gene Name
- kallikrein related peptidase 10
- Gene
- KLK11
- Gene Name
- kallikrein related peptidase 11
There are no transcripts associated with this gene.
- Gene
- KLK9
- Gene Name
- kallikrein related peptidase 9
There are no transcripts associated with this gene.
View Full Product Details