Product Details

SNP ID: rs2271411
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:122216454 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATGGTACCTTCCTAGTTAAAAAAT[A/T]AAAAAAAAAACCCAACACAAAACTT
Phenotype: MIM: 605864 MIM: 605219
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: B3GNT4 PubMed Links

Gene Details

Gene: B3GNT4
Gene Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4

There are no transcripts associated with this gene.

Gene: DIABLO
Gene Name: diablo IAP-binding mitochondrial protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278302.1		Intron			NP_001265231.1
NM_001278303.1		Intron			NP_001265232.1
NM_001278304.1		Intron			NP_001265233.1
NM_001278342.1		Intron			NP_001265271.1
NM_019887.5		Intron			NP_063940.1
NM_138930.3		Intron			NP_620308.1

Gene: LOC101593348
Gene Name: uncharacterized LOC101593348

There are no transcripts associated with this gene.

View Full Product Details