Product Details

SNP ID: rs2271542
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:218274587 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCCAGGCATTCTCCCTGCCCGCAC[C/T]GAGTCTCTCTTCACCCTGGCTACTT
Phenotype: MIM: 603488 MIM: 609023 MIM: 610364
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AAMP PubMed Links

Gene Details

Gene: AAMP
Gene Name: angio associated migratory cell protein

There are no transcripts associated with this gene.

Gene: MIR6513
Gene Name: microRNA 6513

There are no transcripts associated with this gene.

Gene: PNKD
Gene Name: paroxysmal nonkinesigenic dyskinesia

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077399.2	1901	Intron			NP_001070867.1
NM_015488.4	1901	Intron			NP_056303.3
NM_022572.4	1901	Intron			NP_072094.1
XM_017003771.1	1901	Intron			XP_016859260.1
XM_017003772.1	1901	Intron			XP_016859261.1

Gene: TMBIM1
Gene Name: transmembrane BAX inhibitor motif containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321427.1	1901	UTR 3			NP_001308356.1
NM_001321428.1	1901	UTR 3			NP_001308357.1
NM_001321429.1	1901	UTR 3			NP_001308358.1
NM_001321430.1	1901	UTR 3			NP_001308359.1
NM_001321432.1	1901	UTR 3			NP_001308361.1
NM_001321433.1	1901	UTR 3			NP_001308362.1
NM_001321435.1	1901	UTR 3			NP_001308364.1
NM_001321436.1	1901	UTR 3			NP_001308365.1
NM_001321438.1	1901	UTR 3			NP_001308367.1
NM_022152.5	1901	UTR 3			NP_071435.2
XM_011511627.1	1901	UTR 3			XP_011509929.1

View Full Product Details