Product Details

SNP ID: rs2271587
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:3638873 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAGGGGCCAAGAGCAGAGTCTTCCA[G/T]GGGGGCAGAGAGGAGGCCCCCTCAG
Phenotype: MIM: 601625 MIM: 610625
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ART1 PubMed Links

Gene Details

Gene: ART1
Gene Name: ADP-ribosyltransferase 1

There are no transcripts associated with this gene.

Gene: ART5
Gene Name: ADP-ribosyltransferase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001079536.1	1117	Intron			NP_001073004.1
NM_001297668.1	1117	Silent Mutation			NP_001284597.1
NM_053017.4	1117	Intron			NP_443750.2
XM_005252779.3	1117	Silent Mutation			XP_005252836.1
XM_006718136.3	1117	Silent Mutation			XP_006718199.1
XM_011519879.2	1117	Silent Mutation			XP_011518181.1
XM_017017171.1	1117	Silent Mutation			XP_016872660.1

Gene: TRPC2
Gene Name: transient receptor potential cation channel subfamily C member 2, pseudogene

There are no transcripts associated with this gene.

View Full Product Details