Product Details
- SNP ID
-
rs2272280
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:97010818 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- AAAACCACTCTTTCCCCACCCCACC[C/T]CCCCAAACCCTGAACTGGAATCAGG
- Phenotype
-
MIM: 600028
MIM: 600030
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
DLX5
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs144840049] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DLX5
- Gene Name
- distal-less homeobox 5
There are no transcripts associated with this gene.
- Gene
- DLX6
- Gene Name
- distal-less homeobox 6
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_005222.3 |
1653 |
UTR 3 |
|
|
NP_005213.3 |
- Gene
- DLX6-AS1
- Gene Name
- DLX6 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details