Product Details

SNP ID

rs2279819

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.3:126007205 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

AAGTCAGCCGAACCATCACTTCTGC[C/G]AGGTACAGCAGGATTGTCACCTGTC

Phenotype

MIM: 610803

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

SLC41A3 PubMed Links

Additional Information

For this assay, SNP(s) [rs79696429] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

SLC41A3

Gene Name

solute carrier family 41 member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008485.1	1424	Silent Mutation	CTC,CTG	L425L	NP_001008485.1
NM_001008486.1	1424	Silent Mutation	CTC,CTG	L389L	NP_001008486.1
NM_001008487.1	1424	Silent Mutation	CTC,CTG	L399L	NP_001008487.1
NM_001164475.1	1424	Silent Mutation	CTC,CTG	L308L	NP_001157947.1
NM_017836.3	1424	Silent Mutation	CTC,CTG	L425L	NP_060306.3
XM_005247559.1	1424	Silent Mutation	CTC,CTG	L440L	XP_005247616.1
XM_005247562.1	1424	Silent Mutation	CTC,CTG	L425L	XP_005247619.1
XM_005247563.2	1424	Silent Mutation	CTC,CTG	L425L	XP_005247620.1
XM_005247564.1	1424	Silent Mutation	CTC,CTG	L440L	XP_005247621.1
XM_005247565.2	1424	Silent Mutation	CTC,CTG	L399L	XP_005247622.1
XM_006713681.2	1424	Silent Mutation	CTC,CTG	L425L	XP_006713744.1
XM_011512945.1	1424	Silent Mutation	CTC,CTG	L414L	XP_011511247.1
XM_017006705.1	1424	Silent Mutation	CTC,CTG	L440L	XP_016862194.1
XM_017006706.1	1424	Silent Mutation	CTC,CTG	L425L	XP_016862195.1
XM_017006707.1	1424	Silent Mutation	CTC,CTG	L425L	XP_016862196.1
XM_017006708.1	1424	Silent Mutation	CTC,CTG	L389L	XP_016862197.1
XM_017006709.1	1424	Silent Mutation	CTC,CTG	L389L	XP_016862198.1

View Full Product Details