Product Details

SNP ID: rs2303943
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:151078257 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AACAGCAAAGCAGTCACGAGCTGCA[A/C]GTGACTAATCACCAGACAGGCAGAG
Phenotype: MIM: 616813 MIM: 606965 MIM: 109280 MIM: 614792
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: AGAP3 PubMed Links

Gene Details

Gene: AGAP3
Gene Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 3

There are no transcripts associated with this gene.

Gene: FASTK
Gene Name: Fas activated serine/threonine kinase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258461.1		Intron			NP_001245390.1
NM_006712.4		Intron			NP_006703.1
NM_033015.3		Intron			NP_148936.2
XM_005249932.1		Intron			XP_005249989.1
XM_005249933.3		Intron			XP_005249990.1
XM_011515761.2		Intron			XP_011514063.1
XM_011515762.2		Intron			XP_011514064.1
XM_011515763.1		Intron			XP_011514065.1
XM_017011704.1		Intron			XP_016867193.1
XM_017011705.1		Intron			XP_016867194.1
XM_017011706.1		Intron			XP_016867195.1

Gene: SLC4A2
Gene Name: solute carrier family 4 member 2

There are no transcripts associated with this gene.

Gene: TMUB1
Gene Name: transmembrane and ubiquitin like domain containing 1

There are no transcripts associated with this gene.

View Full Product Details