Product Details

SNP ID: rs3010874
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 62
Location: Chr.1:12716131 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTCTGAACCATGTCCTAAATGGTTT[A/C]CACTGCGCACAGCTTCCTCTCAGCC
Phenotype
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: AADACL3 PubMed Links
Additional Information: For this assay, SNP(s) [rs80277373] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001103170.2	17	UTR 5			NP_001096640.2