Product Details

SNP ID: rs2598414
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:76071018 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACTTGCAAACTGAAAAAGGAGGGCA[C/T]TACTGGCCACTGGAAACTGCCAAAA
Phenotype: MIM: 608163 MIM: 603691 MIM: 604858 MIM: 610935
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EXOC7 PubMed Links

Gene Details

Gene: EXOC7
Gene Name: exocyst complex component 7

There are no transcripts associated with this gene.

Gene: GALR2
Gene Name: galanin receptor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003857.3	197	Intron			NP_003848.1
XM_011525427.2	197	UTR 5			XP_011523729.1

Gene: SRP68
Gene Name: signal recognition particle 68

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001260502.1	197	Intron			NP_001247431.1
NM_001260503.1	197	Intron			NP_001247432.1
NM_014230.3	197	Intron			NP_055045.2

Gene: ZACN
Gene Name: zinc activated ion channel

There are no transcripts associated with this gene.

View Full Product Details