Product Details

SNP ID: rs2144687
Assay Type: Functionally tested
NCBI dbSNP Submissions: 36
Location: Chr.1:1921955 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTGTCACCCACACTGCAGGCTGCA[C/T]GTGTTGGCCTACAAAAAATTTATTG
Phenotype: MIM: 610171
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CALML6 PubMed Links

Gene Details

Gene: CALML6
Gene Name: calmodulin like 6

There are no transcripts associated with this gene.

Gene: CFAP74
Gene Name: cilia and flagella associated protein 74

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304360.1	5408	UTR 3			NP_001291289.1
XM_011542333.2	5408	Intron			XP_011540635.2
XM_011542335.1	5408	Intron			XP_011540637.1
XM_011542336.2	5408	Intron			XP_011540638.1
XM_017002641.1	5408	Intron			XP_016858130.1
XM_017002642.1	5408	Intron			XP_016858131.1
XM_017002643.1	5408	Intron			XP_016858132.1
XM_017002644.1	5408	Intron			XP_016858133.1

Gene: TMEM52
Gene Name: transmembrane protein 52

There are no transcripts associated with this gene.

View Full Product Details