Product Details

SNP ID: rs2851011
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.4:99414826 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: CTGTAAAATAAGGAAATTTTGTGGC[T/C]TACTTGAAATAAATAGCAGCTTTAT
Phenotype: MIM: 600086
Polymorphism: T/C, Transition Substitution
Allele Nomenclature
Literature Links: ADH7 PubMed Links
Additional Information: For this assay, SNP(s) [rs57742750] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000673.4		Intron			NP_000664.2
NM_001166504.1		Intron			NP_001159976.1