Product Details

SNP ID
rs2904887
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.8:94929456 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGAAAAAAGTTGAGCCAACCTGTCA[C/T]TCTTCACTCAGATGCCATGAAAGAC
Phenotype
MIM: 612392 MIM: 606185
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
NDUFAF6 PubMed Links
Additional Information
For this assay, SNP(s) [rs141225727] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
NDUFAF6
Gene Name
NADH:ubiquinone oxidoreductase complex assembly factor 6
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_152416.3 1982 Intron NP_689629.2
XM_005250789.2 1982 Intron XP_005250846.1
XM_005250790.2 1982 Intron XP_005250847.1
XM_005250791.2 1982 Intron XP_005250848.1
XM_005250792.2 1982 Intron XP_005250849.1
XM_005250793.2 1982 Intron XP_005250850.1
XM_011516833.2 1982 Intron XP_011515135.1
XM_011516834.2 1982 Intron XP_011515136.1
XM_011516835.2 1982 Intron XP_011515137.1
XM_011516836.2 1982 Intron XP_011515138.1
XM_011516837.2 1982 Intron XP_011515139.1
XM_011516838.2 1982 Intron XP_011515140.1
XM_011516839.2 1982 Intron XP_011515141.1
XM_011516840.2 1982 Intron XP_011515142.1
XM_011516841.2 1982 Intron XP_011515143.1
XM_011516842.2 1982 Intron XP_011515144.1
XM_017013027.1 1982 Intron XP_016868516.1
XM_017013028.1 1982 Intron XP_016868517.1
XM_017013029.1 1982 Intron XP_016868518.1
XM_017013030.1 1982 Intron XP_016868519.1
XM_017013031.1 1982 Intron XP_016868520.1
XM_017013032.1 1982 Intron XP_016868521.1
XM_017013033.1 1982 Intron XP_016868522.1
XM_017013034.1 1982 Intron XP_016868523.1
XM_017013035.1 1982 Intron XP_016868524.1
XM_017013036.1 1982 Intron XP_016868525.1
XM_017013037.1 1982 Intron XP_016868526.1
XM_017013038.1 1982 Intron XP_016868527.1
XM_017013039.1 1982 Intron XP_016868528.1
Gene
TP53INP1
Gene Name
tumor protein p53 inducible nuclear protein 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001135733.1 1982 UTR 3 NP_001129205.1
NM_033285.3 1982 UTR 3 NP_150601.1
XM_011517386.2 1982 UTR 3 XP_011515688.1

View Full Product Details