Product Details

SNP ID: rs2928377
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144424398 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTCACTGTACTCTGTTCCCAAACCC[A/T]GCAGGCCTCCTGGGTGAACGAGGTC
Phenotype: MIM: 607059 MIM: 604546 MIM: 611952
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: SLC39A4 PubMed Links

Gene Details

Gene: SLC39A4
Gene Name: solute carrier family 39 member 4

There are no transcripts associated with this gene.

Gene: TONSL
Gene Name: tonsoku-like, DNA repair protein

There are no transcripts associated with this gene.

Gene: VPS28
Gene Name: VPS28, ESCRT-I subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016208.3		Intron			NP_057292.1
NM_183057.2		Intron			NP_898880.1
XM_005272323.3		Intron			XP_005272380.1
XM_005272324.3		Intron			XP_005272381.1
XM_005272325.3		Intron			XP_005272382.1
XM_011517099.1		Intron			XP_011515401.1
XM_011517100.1		Intron			XP_011515402.1
XM_017013529.1		Intron			XP_016869018.1

View Full Product Details