Product Details

SNP ID: rs2286008
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:61755487 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGGGGCTTTGGACTCCAGAGCCAG[G/T]GCAGGCACGGGACAGGGCAGTGTCT
Phenotype: MIM: 614015 MIM: 608329
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DAGLA PubMed Links

Gene Details

Gene: DAGLA
Gene Name: diacylglycerol lipase alpha

There are no transcripts associated with this gene.

Gene: DKFZP434K028
Gene Name: uncharacterized LOC26070

There are no transcripts associated with this gene.

Gene: MYRF
Gene Name: myelin regulatory factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127392.2		Intron			NP_001120864.1
NM_013279.3		Intron			NP_037411.1
XM_005274222.1		Intron			XP_005274279.1
XM_005274223.1		Intron			XP_005274280.1
XM_005274224.1		Intron			XP_005274281.1
XM_005274225.1		Intron			XP_005274282.1
XM_005274226.1		Intron			XP_005274283.1
XM_005274227.1		Intron			XP_005274284.1
XM_005274228.1		Intron			XP_005274285.1
XM_011545234.2		Intron			XP_011543536.1

View Full Product Details