Product Details

SNP ID: rs1805665
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.12:9069507 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CATAATAAACACATTTTGTGAAGAT[T/C]TCTTGCTTATGGGATTTTAGGAATA
Phenotype: MIM: 103950 MIM: 604874
Polymorphism: T/C, Transition Substitution
Allele Nomenclature
Literature Links: A2M PubMed Links

Gene Details

Gene: A2M
Gene Name: alpha-2-macroglobulin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000014.4		Intron			NP_000005.2
XM_006719056.2		Intron			XP_006719119.1

Gene: A2M-AS1
Gene Name: A2M antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: KLRG1
Gene Name: killer cell lectin like receptor G1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005810.3		Intron			NP_005801.3
XM_017018682.1		Intron			XP_016874171.1
XM_017018683.1		Intron			XP_016874172.1
XM_017018684.1		Intron			XP_016874173.1
XM_017018685.1		Intron			XP_016874174.1

Gene: LINC00612
Gene Name: long intergenic non-protein coding RNA 612

There are no transcripts associated with this gene.

View Full Product Details