Product Details

SNP ID: rs2741583
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45416148 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGCGCCGCTGGGTAGGCGGAAGTA[G/T]CCGCAGGCATGGCGGCGGCTATGCC
Phenotype: MIM: 611453 MIM: 610272
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DBNDD2 PubMed Links

Gene Details

Gene: DBNDD2
Gene Name: dysbindin domain containing 2

There are no transcripts associated with this gene.

Gene: MIR6812
Gene Name: microRNA 6812

There are no transcripts associated with this gene.

Gene: PIGT
Gene Name: phosphatidylinositol glycan anchor biosynthesis class T

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184728.2	4	UTR 5			NP_001171657.1
NM_001184729.2	4	UTR 5			NP_001171658.1
NM_001184730.2	4	UTR 5			NP_001171659.1
NM_015937.5	4	UTR 5			NP_057021.2
XM_005260430.2	4	UTR 5			XP_005260487.1
XM_005260432.2	4	UTR 5			XP_005260489.1

Gene: SYS1-DBNDD2
Gene Name: SYS1-DBNDD2 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details