Product Details

SNP ID: rs61732993
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:143391483 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGTCCTTGAATCCCTGAATACTGC[A/G]AAGAATGCGCTTCTGGTGCCCGGGC
Phenotype: MIM: 179610 MIM: 602002
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EPHA1 PubMed Links

Gene Details

Gene: EPHA1
Gene Name: EPH receptor A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005232.4	2992	Missense Mutation	CGC,TGC	R969C	NP_005223.4
XM_006715880.3	2992	Missense Mutation	CGC,TGC	R854C	XP_006715943.1

Gene: FAM131B
Gene Name: family with sequence similarity 131 member B

There are no transcripts associated with this gene.

Gene: MIR6892
Gene Name: microRNA 6892

There are no transcripts associated with this gene.

Gene: ZYX
Gene Name: zyxin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001010972.1	2992	Intron			NP_001010972.1
NM_003461.4	2992	Intron			NP_003452.1
XM_011516569.2	2992	Intron			XP_011514871.2
XM_017012587.1	2992	Intron			XP_016868076.1

View Full Product Details