Product Details

SNP ID: hCV25599581
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:72097749 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTAGGGTACTGTATAAGCCGCAGT[C/G]AGGCTGGGGGCCAAGGGGGTGGGGT
Phenotype: MIM: 614717 MIM: 613510 MIM: 612414
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ANAPC15 PubMed Links

Gene Details

Gene: ANAPC15
Gene Name: anaphase promoting complex subunit 15

There are no transcripts associated with this gene.

Gene: LAMTOR1
Gene Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017907.2	722	UTR 3			NP_060377.1

Gene: LRTOMT
Gene Name: leucine rich transmembrane and O-methyltransferase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145307.4	722	Intron			NP_001138779.1
NM_001145308.4	722	Intron			NP_001138780.1
NM_001145309.3	722	Intron			NP_001138781.1
NM_001145310.3	722	Intron			NP_001138782.1
NM_001205138.3	722	Intron			NP_001192067.1
NM_001271471.2	722	Intron			NP_001258400.1
NM_001318803.1	722	Intron			NP_001305732.1
NM_145309.5	722	Intron			NP_660352.1

View Full Product Details