Product Details

SNP ID

rs61730321

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.14:103100449 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCCAAGGAAGATACGGGCCTGTTCC[A/G]GCGAAGCTCCTGCTCCCTGTTCCGG

Phenotype

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

EXOC3L4 PubMed Links

Additional Information

For this assay, SNP(s) [rs2297067] are located under a probe and SNP(s) [rs61730322] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

EXOC3L4

Gene Name

exocyst complex component 3 like 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077594.1	713	Missense Mutation	CAG,CGG	Q77R	NP_001071062.1
XM_011537323.2	713	Missense Mutation	CAG,CGG	Q135R	XP_011535625.1
XM_011537324.2	713	Missense Mutation	CAG,CGG	Q135R	XP_011535626.1
XM_011537325.2	713	Missense Mutation	CAG,CGG	Q77R	XP_011535627.1
XM_011537327.2	713	Missense Mutation	CAG,CGG	Q77R	XP_011535629.1
XM_011537328.2	713	Missense Mutation	CAG,CGG	Q77R	XP_011535630.1
XM_011537329.2	713	Missense Mutation	CAG,CGG	Q77R	XP_011535631.1
XM_011537330.2	713	Missense Mutation	CAG,CGG	Q77R	XP_011535632.1
XM_011537331.1	713	Missense Mutation	CAG,CGG	Q77R	XP_011535633.1
XM_011537332.2	713	Missense Mutation	CAG,CGG	Q77R	XP_011535634.1
XM_011537333.2	713	Missense Mutation	CAG,CGG	Q114R	XP_011535635.1
XM_011537334.1	713	Intron			XP_011535636.1

View Full Product Details