Product Details

SNP ID: rs373186003
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:143717621 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGATGGGAAGGAGGAGCCTCATG[C/T]CTGTAGGGACAATCTGGGTGGGCAG
Phenotype: MIM: 611927
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC166 PubMed Links

Gene Details

Gene: CCDC166
Gene Name: coiled-coil domain containing 166

There are no transcripts associated with this gene.

Gene: FAM83H
Gene Name: family with sequence similarity 83 member H

There are no transcripts associated with this gene.

Gene: LOC101928160
Gene Name: uncharacterized LOC101928160

There are no transcripts associated with this gene.

Gene: MAPK15
Gene Name: mitogen-activated protein kinase 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_139021.2		Intron			NP_620590.2
XM_011516925.2		Intron			XP_011515227.1
XM_011516926.2		Intron			XP_011515228.1
XM_011516927.2		Intron			XP_011515229.1
XM_011516928.2		Intron			XP_011515230.1
XM_017013218.1		Intron			XP_016868707.1

View Full Product Details