Product Details

SNP ID: rs62639980
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 26
Location: Chr.1:966542 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTACGACTCTGGCCATGGGGAACA[G/A]CCACTGTGTCCCTCAGGCCCCCAGG
Phenotype: MIM: 610770 MIM: 615921
Polymorphism: G/A, Transition Substitution
Allele Nomenclature
Literature Links: KLHL17 PubMed Links
Additional Information: For this assay, SNP(s) [rs149741186] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Protein ID
NM_198317.2	723	Intron	NP_938073.1
XM_006710600.3	723	Intron	XP_006710663.1
XM_006710601.3	723	Intron	XP_006710664.1

There are no transcripts associated with this gene.

There are no transcripts associated with this gene.

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001160184.1	723	Missense Mutation	AAC,AGC	N4S	NP_001153656.1
NM_032129.2	723	Missense Mutation	AAC,AGC	N4S	NP_115505.2
XM_006710944.3	723	Missense Mutation	AAC,AGC	N112S	XP_006711007.2
XM_011542248.2	723	Missense Mutation	AAC,AGC	N112S	XP_011540550.2
XM_017002474.1	723	Missense Mutation	AAC,AGC	N112S	XP_016857963.1
XM_017002475.1	723	Missense Mutation	AAC,AGC	N112S	XP_016857964.1
XM_017002476.1	723	Missense Mutation	AAC,AGC	N112S	XP_016857965.1
XM_017002477.1	723	Missense Mutation	AAC,AGC	N112S	XP_016857966.1
XM_017002478.1	723	Missense Mutation	AAC,AGC	N112S	XP_016857967.1
XM_017002479.1	723	Missense Mutation	AAC,AGC	N112S	XP_016857968.1