Product Details

SNP ID: rs4938621
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:119021567 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGTCTTAATCAGGTGGGTGACATAA[C/T]AAAGTTACTTCACTTCTCTGGTCTC
Phenotype: MIM: 180465 MIM: 602671 MIM: 610971
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC84 PubMed Links

Gene Details

Gene: CCDC84
Gene Name: coiled-coil domain containing 84

There are no transcripts associated with this gene.

Gene: MIR3656
Gene Name: microRNA 3656

There are no transcripts associated with this gene.

Gene: RPS25
Gene Name: ribosomal protein S25

There are no transcripts associated with this gene.

Gene: SLC37A4
Gene Name: solute carrier family 37 member 4

There are no transcripts associated with this gene.

Gene: TRAPPC4
Gene Name: trafficking protein particle complex 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318486.1		Intron			NP_001305415.1
NM_001318488.1		Intron			NP_001305417.1
NM_001318489.1		Intron			NP_001305418.1
NM_001318490.1		Intron			NP_001305419.1
NM_001318492.1		Intron			NP_001305421.1
NM_001318494.1		Intron			NP_001305423.1
NM_016146.5		Intron			NP_057230.1

View Full Product Details