Product Details

SNP ID

rs189084607

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.18:58865288 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGCTGGAGAATGCTACTTTGCATGC[A/T]TTTTTTCTCTTGCAGGGTATGTTCT

Phenotype

Polymorphism

A/T, Transversion Substitution

Allele Nomenclature

Literature Links

ZNF532 PubMed Links

Additional Information

For this assay, SNP(s) [rs199702049] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZNF532

Gene Name

zinc finger protein 532

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318726.1	677	Intron			NP_001305655.1
NM_001318727.1	677	Intron			NP_001305656.1
NM_001318728.1	677	Intron			NP_001305657.1
NM_018181.5	677	Intron			NP_060651.2
XM_011526054.2	677	Intron			XP_011524356.1
XM_011526067.2	677	Intron			XP_011524369.1
XM_017025809.1	677	Intron			XP_016881298.1
XM_017025810.1	677	Intron			XP_016881299.1
XM_017025811.1	677	UTR 5			XP_016881300.1
XM_017025812.1	677	Intron			XP_016881301.1
XM_017025813.1	677	Intron			XP_016881302.1
XM_017025814.1	677	Intron			XP_016881303.1
XM_017025815.1	677	Intron			XP_016881304.1
XM_017025816.1	677	Intron			XP_016881305.1
XM_017025817.1	677	Intron			XP_016881306.1
XM_017025818.1	677	Intron			XP_016881307.1
XM_017025819.1	677	Intron			XP_016881308.1
XM_017025820.1	677	Intron			XP_016881309.1
XM_017025821.1	677	Intron			XP_016881310.1
XM_017025822.1	677	Intron			XP_016881311.1
XM_017025823.1	677	Intron			XP_016881312.1
XM_017025824.1	677	Intron			XP_016881313.1
XM_017025825.1	677	UTR 5			XP_016881314.1
XM_017025826.1	677	Intron			XP_016881315.1
XM_017025827.1	677	Intron			XP_016881316.1
XM_017025828.1	677	Intron			XP_016881317.1
XM_017025829.1	677	Intron			XP_016881318.1
XM_017025830.1	677	Intron			XP_016881319.1
XM_017025831.1	677	Intron			XP_016881320.1

View Full Product Details