Product Details

SNP ID: hCV25628091
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7484898 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCCCTTCCCCCCTCCTCCCCTGG[C/G]GGGCGGGGCCGGACGGGGGCTGCGG
Phenotype: MIM: 180660 MIM: 612308
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: POLR2A PubMed Links

Gene Details

Gene: POLR2A
Gene Name: RNA polymerase II subunit A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000937.4		Intron			NP_000928.1

Gene: SLC35G6
Gene Name: solute carrier family 35 member G6

There are no transcripts associated with this gene.

Gene: ZBTB4
Gene Name: zinc finger and BTB domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001128833.1		Intron			NP_001122305.1
NM_020899.3		Intron			NP_065950.2

View Full Product Details