Product Details

SNP ID: rs17847683
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:38595940 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGGGGAGGAAGGAGGGTTCTCACC[A/G]TCCATCAACACCATCACCATATCTT
Phenotype: MIM: 601983 MIM: 180901
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC105372397 PubMed Links

Gene Details

Gene: LOC105372397
Gene Name: uncharacterized LOC105372397

There are no transcripts associated with this gene.

Gene: MAP4K1
Gene Name: mitogen-activated protein kinase kinase kinase kinase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042600.2	2318	Silent Mutation	GAC,GAT	D726D	NP_001036065.1
NM_007181.5	2318	Silent Mutation	GAC,GAT	D726D	NP_009112.1
XM_011526403.1	2318	Silent Mutation	GAC,GAT	D766D	XP_011524705.1
XM_011526404.1	2318	Silent Mutation	GAC,GAT	D766D	XP_011524706.1
XM_017026231.1	2318	Silent Mutation	GAC,GAT	D753D	XP_016881720.1

Gene: RYR1
Gene Name: ryanodine receptor 1

There are no transcripts associated with this gene.

View Full Product Details