Product Details

SNP ID: rs45537633
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:41150086 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCCAAGTTTCTCCCCAAATCTGG[A/G]AGGGTGGGATGCCAAGGGAGACCAT
Phenotype: MIM: 605086 MIM: 609714
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ADCY10P1 PubMed Links

Gene Details

Gene: ADCY10P1
Gene Name: adenylate cyclase 10, soluble pseudogene 1

There are no transcripts associated with this gene.

Gene: LOC105375056
Gene Name: uncharacterized LOC105375056

There are no transcripts associated with this gene.

Gene: TREM2
Gene Name: triggering receptor expressed on myeloid cells 2

There are no transcripts associated with this gene.

Gene: TREML1
Gene Name: triggering receptor expressed on myeloid cells like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271807.1		Intron			NP_001258736.1
NM_001271808.1		Intron			NP_001258737.1
NM_178174.3		Intron			NP_835468.1
XM_017010822.1		Intron			XP_016866311.1
XM_017010823.1		Intron			XP_016866312.1
XM_017010824.1		Intron			XP_016866313.1
XM_017010825.1		Intron			XP_016866314.1

View Full Product Details