Product Details

SNP ID: rs4148878
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32854409 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAACGGGAGCGCAGGGAGGTCGCC[G/T]GTAGCAGCCAGCGCTTGCAACCCGC
Phenotype: MIM: 177046 MIM: 177045 MIM: 170260
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: PSMB8 PubMed Links

Gene Details

Gene: PSMB8
Gene Name: proteasome subunit beta 8

There are no transcripts associated with this gene.

Gene: PSMB8-AS1
Gene Name: PSMB8 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: PSMB9
Gene Name: proteasome subunit beta 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002800.4		Intron			NP_002791.1

Gene: TAP1
Gene Name: transporter 1, ATP binding cassette subfamily B member

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000593.5		Intron			NP_000584.2
NM_001292022.1		Intron			NP_001278951.1

View Full Product Details