Product Details

SNP ID: rs113534072
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:28975443 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATAGTCTAGGAGAGGGGAGCCAGGG[A/T]CCCGAGGGTGGCGCTGCTTTGCCGG
Phenotype: MIM: 602354 MIM: 614525 MIM: 612583
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: LAT PubMed Links

Gene Details

Gene: LAT
Gene Name: linker for activation of T-cells

There are no transcripts associated with this gene.

Gene: NFATC2IP
Gene Name: nuclear factor of activated T-cells 2 interacting protein

There are no transcripts associated with this gene.

Gene: SPNS1
Gene Name: sphingolipid transporter 1 (putative)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142448.1		Intron			NP_001135920.1
NM_001142449.1		Intron			NP_001135921.1
NM_001142450.1		Intron			NP_001135922.1
NM_001142451.1		Intron			NP_001135923.1
NM_032038.2		Intron			NP_114427.1
XM_006721096.3		Intron			XP_006721159.1
XM_017023757.1		Intron			XP_016879246.1
XM_017023758.1		Intron			XP_016879247.1
XM_017023759.1		Intron			XP_016879248.1

View Full Product Details