Product Details

SNP ID: rs139707997
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6871342 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGCTGGGAGAGAGAAGGAGGGGAA[G/T]GTAAGTATGGGTGCAGCCACCAGCC
Phenotype: MIM: 611658 MIM: 190450 MIM: 601447
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LOC105369632 PubMed Links

Gene Details

Gene: LOC105369632
Gene Name: uncharacterized LOC105369632

There are no transcripts associated with this gene.

Gene: SPSB2
Gene Name: splA/ryanodine receptor domain and SOCS box containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001146316.1		Intron			NP_001139788.1
NM_001319670.1		Intron			NP_001306599.1
NM_032641.3		Intron			NP_116030.1

Gene: TPI1
Gene Name: triosephosphate isomerase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000365.5		Intron			NP_000356.1
NM_001159287.1		Intron			NP_001152759.1
NM_001258026.1		Intron			NP_001244955.1

Gene: USP5
Gene Name: ubiquitin specific peptidase 5

There are no transcripts associated with this gene.

View Full Product Details