Product Details

SNP ID: hCV25754300
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:47571723 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACAGGGCTTAAGCCCAGACTTGAC[A/G]TAACAGAAATGTGCCAATAGGTAAT
Phenotype: MIM: 601074 MIM: 603846 MIM: 609538
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CELF1 PubMed Links

Gene Details

Gene: CELF1
Gene Name: CUGBP, Elav-like family member 1

There are no transcripts associated with this gene.

Gene: KBTBD4
Gene Name: kelch repeat and BTB domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318716.1	893	Intron			NP_001305645.1
NM_001318717.1	893	Intron			NP_001305646.1
NM_001318718.1	893	Intron			NP_001305647.1
NM_001318719.1	893	Intron			NP_001305648.1
NM_001318720.1	893	Intron			NP_001305649.1
NM_001318721.1	893	Intron			NP_001305650.1
NM_001318722.1	893	Intron			NP_001305651.1
NM_001318723.1	893	Intron			NP_001305652.1
NM_001318724.1	893	Intron			NP_001305653.1
NM_001318725.1	893	Intron			NP_001305654.1
NM_016506.6	893	Intron			NP_057590.3
NM_018095.5	893	Intron			NP_060565.4

Gene: NDUFS3
Gene Name: NADH:ubiquinone oxidoreductase core subunit S3

There are no transcripts associated with this gene.

Gene: PTPMT1
Gene Name: protein tyrosine phosphatase, mitochondrial 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001143984.1	893	UTR 3			NP_001137456.1
NM_175732.2	893	UTR 3			NP_783859.1

View Full Product Details