Product Details

SNP ID: rs35968178
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50348958 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGTACATCATACTCCTGGGCCAC[C/G]GGAGGGTCTGGCCGCTGCTCAATCA
Phenotype: MIM: 607068 MIM: 607072 MIM: 605082 MIM: 607069 MIM: 607070
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CYB561D2 PubMed Links

Gene Details

Gene: CYB561D2
Gene Name: cytochrome b561 family member D2

There are no transcripts associated with this gene.

Gene: NPRL2
Gene Name: NPR2-like, GATOR1 complex subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006545.4	904	Silent Mutation	CCC,CCG	P167P	NP_006536.3
XM_005264808.4	904	Silent Mutation	CCC,CCG	P47P	XP_005264865.1
XM_011533288.2	904	Silent Mutation	CCC,CCG	P164P	XP_011531590.1
XM_017005555.1	904	Silent Mutation	CCC,CCG	P47P	XP_016861044.1
XM_017005556.1	904	Silent Mutation	CCC,CCG	P47P	XP_016861045.1

Gene: RASSF1
Gene Name: Ras association domain family member 1

There are no transcripts associated with this gene.

Gene: TMEM115
Gene Name: transmembrane protein 115

There are no transcripts associated with this gene.

Gene: ZMYND10
Gene Name: zinc finger MYND-type containing 10

There are no transcripts associated with this gene.

View Full Product Details