Product Details

SNP ID: rs190764015
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:38711830 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGAGAAGAGGGTTTGCAATTTCTC[A/T]CAAATCTCTCCCGCAGAAGACATCC
Phenotype: MIM: 600328
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: LOC105371763 PubMed Links

Gene Details

Gene: LOC105371763
Gene Name: uncharacterized LOC105371763

There are no transcripts associated with this gene.

Gene: MIR4726
Gene Name: microRNA 4726

There are no transcripts associated with this gene.

Gene: MIR4734
Gene Name: microRNA 4734

There are no transcripts associated with this gene.

Gene: MLLT6
Gene Name: MLLT6, PHD finger domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005937.3		Intron			NP_005928.2
XM_006721911.2		Intron			XP_006721974.1
XM_017024648.1		Intron			XP_016880137.1
XM_017024649.1		Intron			XP_016880138.1
XM_017024650.1		Intron			XP_016880139.1

View Full Product Details