Product Details

SNP ID: rs73272359
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:73499319 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCATACATACAAGGGAAAGAATGAA[C/T]CAAGCTGTGCTTTTGATTCCATTTC
Phenotype: MIM: 114106
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PPP3CB PubMed Links

Gene Details

There are no transcripts associated with this gene.

There are no transcripts associated with this gene.

Transcript Accession	SNP Type	Protein ID
NM_001320437.1	Intron	NP_001307366.1
NM_001320441.1	Intron	NP_001307370.1
NM_152586.3	Intron	NP_689799.3
XM_005269582.2	Intron	XP_005269639.1
XM_011539368.2	Intron	XP_011537670.1
XM_017015759.1	Intron	XP_016871248.1
XM_017015760.1	Intron	XP_016871249.1
XM_017015761.1	Intron	XP_016871250.1
XM_017015762.1	Intron	XP_016871251.1
XM_017015763.1	Intron	XP_016871252.1
XM_017015764.1	Intron	XP_016871253.1
XM_017015765.1	Intron	XP_016871254.1
XM_017015766.1	Intron	XP_016871255.1
XM_017015767.1	Intron	XP_016871256.1
XM_017015768.1	Intron	XP_016871257.1
XM_017015769.1	Intron	XP_016871258.1
XM_017015770.1	Intron	XP_016871259.1
XM_017015771.1	Intron	XP_016871260.1
XM_017015772.1	Intron	XP_016871261.1
XM_017015773.1	Intron	XP_016871262.1
XM_017015774.1	Intron	XP_016871263.1
XM_017015775.1	Intron	XP_016871264.1
XM_017015776.1	Intron	XP_016871265.1
XM_017015777.1	Intron	XP_016871266.1
XM_017015778.1	Intron	XP_016871267.1
XM_017015779.1	Intron	XP_016871268.1
XM_017015780.1	Intron	XP_016871269.1
XM_017015781.1	Intron	XP_016871270.1
XM_017015782.1	Intron	XP_016871271.1
XM_017015783.1	Intron	XP_016871272.1
XM_017015784.1	Intron	XP_016871273.1
XM_017015785.1	Intron	XP_016871274.1
XM_017015786.1	Intron	XP_016871275.1