Product Details

SNP ID: rs111604078
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7420775 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAATTAGCCCCTTCCCTTCTTGCTC[A/G]CCCCTCTCAGACAACATAGCTGTGT
Phenotype: MIM: 606479 MIM: 615116
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C17orf74 PubMed Links

Gene Details

Gene: C17orf74
Gene Name: chromosome 17 open reading frame 74

There are no transcripts associated with this gene.

Gene: LOC107983988
Gene Name: proteoglycan 4-like

There are no transcripts associated with this gene.

Gene: NLGN2
Gene Name: neuroligin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020795.3		Intron			NP_065846.1
XM_005256744.3		Intron			XP_005256801.1
XM_017024897.1		Intron			XP_016880386.1

Gene: SPEM1
Gene Name: spermatid maturation 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_199339.2		Intron			NP_955371.2

View Full Product Details