Product Details

SNP ID
rs35549084
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.17:80415678 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GCAAGCTCGGCTGAAGGCCCACGTC[A/G]TAGACCGGGACACCGAGGCGTGGCA
Phenotype
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
ENDOV PubMed Links

Gene Details

Gene
ENDOV
Gene Name
endonuclease V
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001164637.2 163 Missense Mutation ATA,GTA I29V NP_001158109.1
NM_001164638.1 163 Missense Mutation ATA,GTA I29V NP_001158110.1
NM_173627.4 163 Missense Mutation ATA,GTA I29V NP_775898.2
XM_005257244.3 163 Missense Mutation ATA,GTA I29V XP_005257301.1
XM_005257246.3 163 Missense Mutation ATA,GTA I29V XP_005257303.1
XM_006721837.3 163 Missense Mutation ATA,GTA I29V XP_006721900.1
XM_011524655.1 163 Missense Mutation ATA,GTA I29V XP_011522957.1
XM_011524656.1 163 Missense Mutation ATA,GTA I29V XP_011522958.1
XM_011524657.1 163 Missense Mutation ATA,GTA I29V XP_011522959.1
XM_011524658.2 163 Missense Mutation ATA,GTA I29V XP_011522960.1
XM_011524660.1 163 Missense Mutation ATA,GTA I29V XP_011522962.1
XM_011524661.2 163 Missense Mutation ATA,GTA I29V XP_011522963.1
XM_011524662.1 163 Missense Mutation ATA,GTA I29V XP_011522964.1
XM_011524663.1 163 Missense Mutation ATA,GTA I29V XP_011522965.1
XM_011524664.2 163 UTR 5 XP_011522966.1
XM_011524666.1 163 UTR 5 XP_011522968.1
XM_011524667.2 163 UTR 5 XP_011522969.1
XM_011524669.2 163 Missense Mutation ATA,GTA I29V XP_011522971.1
XM_011524670.1 163 Missense Mutation ATA,GTA I29V XP_011522972.1
XM_011524671.2 163 Missense Mutation ATA,GTA I29V XP_011522973.1
XM_011524672.1 163 UTR 5 XP_011522974.1
XM_011524673.1 163 UTR 5 XP_011522975.1
XM_011524674.1 163 UTR 5 XP_011522976.1
XM_011524675.1 163 UTR 5 XP_011522977.1
XM_011524676.1 163 UTR 5 XP_011522978.1
XM_011524677.1 163 UTR 5 XP_011522979.1
XM_011524678.2 163 Intron XP_011522980.1
XM_017024508.1 163 UTR 5 XP_016879997.1
XM_017024509.1 163 UTR 5 XP_016879998.1
XM_017024510.1 163 Missense Mutation ATA,GTA I29V XP_016879999.1
XM_017024511.1 163 Missense Mutation ATA,GTA I29V XP_016880000.1
XM_017024512.1 163 UTR 5 XP_016880001.1
XM_017024513.1 163 Intron XP_016880002.1
XM_017024514.1 163 UTR 5 XP_016880003.1
XM_017024515.1 163 UTR 5 XP_016880004.1
XM_017024516.1 163 Intron XP_016880005.1
XM_017024517.1 163 UTR 5 XP_016880006.1
XM_017024518.1 163 UTR 5 XP_016880007.1
XM_017024519.1 163 UTR 5 XP_016880008.1
XM_017024520.1 163 UTR 5 XP_016880009.1
Gene
LOC100294362
Gene Name
uncharacterized LOC100294362
There are no transcripts associated with this gene.

Gene
MIR4730
Gene Name
microRNA 4730
There are no transcripts associated with this gene.

View Full Product Details