Product Details

SNP ID: rs3135955
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:48469042 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCACACATGGGGCGTAAGGAACCGC[A/G]CCTGCACACCACTCACGCACACACA
Phenotype: MIM: 606605 MIM: 607290 MIM: 606609
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATRIP PubMed Links

Gene Details

Gene: ATRIP
Gene Name: ATR interacting protein

There are no transcripts associated with this gene.

Gene: SHISA5
Gene Name: shisa family member 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272065.1	1104	Intron			NP_001258994.1
NM_001272066.1	1104	UTR 3			NP_001258995.1
NM_001272067.1	1104	UTR 3			NP_001258996.1
NM_001272068.1	1104	UTR 3			NP_001258997.1
NM_001272082.1	1104	UTR 3			NP_001259011.1
NM_001272083.1	1104	UTR 3			NP_001259012.1
NM_016479.4	1104	Intron			NP_057563.3
XM_005265205.1	1104	UTR 3			XP_005265262.1
XM_006713188.2	1104	UTR 3			XP_006713251.1
XM_011533796.1	1104	UTR 3			XP_011532098.1

Gene: TREX1
Gene Name: three prime repair exonuclease 1

There are no transcripts associated with this gene.

View Full Product Details