Product Details

SNP ID: rs116941897
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:1972945 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTACTACTCTTCTTGGCAACAGAGT[C/G]AAAAAGGTTTTAAAGATGTTCCCGG
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: KBTBD11 PubMed Links

Gene Details

Gene: KBTBD11
Gene Name: kelch repeat and BTB domain containing 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014867.2		Intron			NP_055682.1
XM_011534771.2		Intron			XP_011533073.1
XM_011534772.2		Intron			XP_011533074.1
XM_017014114.1		Intron			XP_016869603.1
XM_017014115.1		Intron			XP_016869604.1
XM_017014116.1		Intron			XP_016869605.1
XM_017014117.1		Intron			XP_016869606.1

Gene: KBTBD11-OT1
Gene Name: KBTBD11 overlapping transcript 1

There are no transcripts associated with this gene.

Gene: LOC101928058
Gene Name: uncharacterized LOC101928058

There are no transcripts associated with this gene.

View Full Product Details