Product Details

SNP ID: hCV25997883
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1960916 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGGGGGACAGAGTAAGGTAATGC[A/C]TGTGGAACTCTGAGGATGATGCCTG
Phenotype: MIM: 603843 MIM: 603624
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: NDUFB10 PubMed Links

Gene Details

Gene: NDUFB10
Gene Name: NADH:ubiquinone oxidoreductase subunit B10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004548.2		Intron			NP_004539.1

Gene: RNF151
Gene Name: ring finger protein 151

There are no transcripts associated with this gene.

Gene: RPL3L
Gene Name: ribosomal protein L3 like

There are no transcripts associated with this gene.

Gene: RPS2
Gene Name: ribosomal protein S2

There are no transcripts associated with this gene.

Gene: SNHG9
Gene Name: small nucleolar RNA host gene 9

There are no transcripts associated with this gene.

Gene: SNORA10
Gene Name: small nucleolar RNA, H/ACA box 10

There are no transcripts associated with this gene.

Gene: SNORA64
Gene Name: small nucleolar RNA, H/ACA box 64

There are no transcripts associated with this gene.

Gene: SNORA78
Gene Name: small nucleolar RNA, H/ACA box 78

There are no transcripts associated with this gene.

View Full Product Details