Product Details

SNP ID: rs61742234
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:36010578 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCTGGGGGCCCACCTGTTCTGTAG[C/G]GTCATCGTCCTCTGGCCGCCGCGGC
Phenotype: MIM: 613304 MIM: 607382 MIM: 615535
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ALKBH6 PubMed Links

Gene Details

Gene: ALKBH6
Gene Name: alkB homolog 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297701.1	579	Missense Mutation	CCT,GCT	P148A	NP_001284630.1
NM_032878.3	579	Missense Mutation	CCT,GCT	P176A	NP_116267.3
NM_198867.1	579	UTR 3			NP_942567.1
XM_005259357.4	579	Missense Mutation	CCT,GCT	P148A	XP_005259414.1

Gene: CLIP3
Gene Name: CAP-Gly domain containing linker protein 3

There are no transcripts associated with this gene.

Gene: LOC101927572
Gene Name: uncharacterized LOC101927572

There are no transcripts associated with this gene.

Gene: SYNE4
Gene Name: spectrin repeat containing nuclear envelope family member 4

There are no transcripts associated with this gene.

View Full Product Details