Product Details

SNP ID: rs10900862
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:139396890 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGTCCAGCACCTGGGCCATGTAGCT[C/T]TCCTGCTGCTTCTGGATCCGGAAGT
Phenotype: MIM: 609447
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MZB1 PubMed Links

Gene Details

Gene: MZB1
Gene Name: marginal zone B and B1 cell specific protein

There are no transcripts associated with this gene.

Gene: PROB1
Gene Name: proline rich basic protein 1

There are no transcripts associated with this gene.

Gene: SPATA24
Gene Name: spermatogenesis associated 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_194296.1	555	Silent Mutation	GAA,GAG	E176E	NP_919272.1
XM_005271916.4	555	Missense Mutation	AAA,AGA	K185R	XP_005271973.1
XM_011543252.2	555	Missense Mutation	AAA,AGA	K146R	XP_011541554.1
XM_011543253.2	555	Missense Mutation	AAA,AGA	K146R	XP_011541555.1
XM_011543254.2	555	Intron			XP_011541556.1

View Full Product Details