Product Details

SNP ID: hCV26230848
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:273516 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGTCATCTTTTCTGATTCTGTGT[A/G]TAGTTTGCTTTTCCAGATCCGTGCC
Phenotype: MIM: 601057 MIM: 600857
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HRAT5 PubMed Links

Gene Details

Gene: HRAT5
Gene Name: heart tissue-associated transcript 5

There are no transcripts associated with this gene.

Gene: PDCD6
Gene Name: programmed cell death 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267556.1		Intron			NP_001254485.1
NM_001267557.1		Intron			NP_001254486.1
NM_001267558.1		Intron			NP_001254487.1
NM_001267559.1		Intron			NP_001254488.1
NM_013232.3		Intron			NP_037364.1

Gene: SDHA
Gene Name: succinate dehydrogenase complex flavoprotein subunit A

There are no transcripts associated with this gene.

View Full Product Details