Product Details

SNP ID: rs12521546
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:10444019 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGGAACATGGACCTGGATACCTTTG[A/G]GGCTGTTATTTTACCCACCAACTGA
Phenotype: MIM: 613297 MIM: 611756
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MARCH6 PubMed Links

Gene Details

Gene: MARCH6
Gene Name: membrane associated ring-CH-type finger 6

There are no transcripts associated with this gene.

Gene: ROPN1L
Gene Name: rhophilin associated tail protein 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001201466.1		Intron			NP_001188395.1
NM_031916.4		Intron			NP_114122.2
XM_006714503.2		Intron			XP_006714566.1
XM_006714504.2		Intron			XP_006714567.1
XM_017009946.1		Intron			XP_016865435.1
XM_017009947.1		Intron			XP_016865436.1

Gene: ROPN1L-AS1
Gene Name: ROPN1L antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details