Product Details

SNP ID: rs35274510
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:17872189 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCCTCTCGCCGCTTCCCACCCCAG[A/C]CGGAGCGGGGACAGGCTGCCGAGCA
Phenotype: MIM: 604178 MIM: 601843
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: RPL18A PubMed Links

Gene Details

Gene: RPL18A
Gene Name: ribosomal protein L18a

There are no transcripts associated with this gene.

Gene: SLC5A5
Gene Name: solute carrier family 5 member 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000453.2	796	UTR 5			NP_000444.1
XM_011528192.2	796	UTR 5			XP_011526494.1
XM_011528193.2	796	Intron			XP_011526495.1
XM_011528194.2	796	Intron			XP_011526496.1
XM_017027158.1	796	Intron			XP_016882647.1

Gene: SNORA68
Gene Name: small nucleolar RNA, H/ACA box 68

There are no transcripts associated with this gene.

View Full Product Details