Product Details
- SNP ID
-
rs13255846
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.8:102254723 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTTTCCCCAAAGGAGTAAGTCTAGA[G/T]TTAGTAGAGGAAAAAAAGGTGACTT
- Phenotype
-
MIM: 608413
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
UBR5
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs76603502] are located under a probe and SNP(s) [rs148188146] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- UBR5
- Gene Name
- ubiquitin protein ligase E3 component n-recognin 5
- Gene
- UBR5-AS1
- Gene Name
- UBR5 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details