Product Details

SNP ID

rs187192

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.5:88194409 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CCAATCAACCACTGATGGCCACTTA[G/T]GTTGACCCCATGACTTTGCCACTGT

Phenotype

Polymorphism

G/T, Transversion Substitution

Allele Nomenclature

Literature Links

TMEM161B PubMed Links

Additional Information

For this assay, SNP(s) [rs75762615] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

TMEM161B

Gene Name

transmembrane protein 161B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001289007.1	3209	Intron			NP_001275936.1
NM_001289008.1	3209	Intron			NP_001275937.1
NM_153354.4	3209	Intron			NP_699185.1
XM_006714553.1	3209	Intron			XP_006714616.1
XM_006714554.3	3209	Intron			XP_006714617.1
XM_006714555.3	3209	Intron			XP_006714618.1
XM_006714556.3	3209	Intron			XP_006714619.2
XM_011543201.2	3209	Intron			XP_011541503.1
XM_011543202.2	3209	Intron			XP_011541504.2
XM_011543203.2	3209	Intron			XP_011541505.2
XM_011543204.2	3209	Intron			XP_011541506.2
XM_017009093.1	3209	Intron			XP_016864582.1
XM_017009094.1	3209	Intron			XP_016864583.1
XM_017009095.1	3209	Intron			XP_016864584.1
XM_017009096.1	3209	Intron			XP_016864585.1
XM_017009097.1	3209	Intron			XP_016864586.1
XM_017009098.1	3209	Intron			XP_016864587.1
XM_017009099.1	3209	Intron			XP_016864588.1
XM_017009100.1	3209	Intron			XP_016864589.1
XM_017009101.1	3209	Intron			XP_016864590.1
XM_017009102.1	3209	Intron			XP_016864591.1
XM_017009103.1	3209	Intron			XP_016864592.1
XM_017009104.1	3209	Intron			XP_016864593.1
XM_017009105.1	3209	Intron			XP_016864594.1
XM_017009106.1	3209	Intron			XP_016864595.1
XM_017009107.1	3209	Intron			XP_016864596.1
XM_017009108.1	3209	Intron			XP_016864597.1
XM_017009109.1	3209	UTR 3			XP_016864598.1
XM_017009110.1	3209	UTR 3			XP_016864599.1

View Full Product Details