Product Details

SNP ID: rs12763652
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:126429405 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTTCAGTCCCTGCCACAGTCCAGAC[C/T]CTTAGGAGAAATAGTTTCTCTCCTC
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C10orf90 PubMed Links

Gene Details

Gene: C10orf90
Gene Name: chromosome 10 open reading frame 90

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001004298.2		Intron			NP_001004298.2
XM_005269491.1		Intron			XP_005269548.1
XM_005269492.2		Intron			XP_005269549.1
XM_011539216.1		Intron			XP_011537518.1
XM_011539217.2		Intron			XP_011537519.1
XM_011539220.2		Intron			XP_011537522.1
XM_011539222.2		Intron			XP_011537524.1
XM_011539223.2		Intron			XP_011537525.1
XM_011539224.2		Intron			XP_011537526.1
XM_011539226.1		Intron			XP_011537528.1
XM_011539227.2		Intron			XP_011537529.1
XM_011539230.2		Intron			XP_011537532.1
XM_011539231.1		Intron			XP_011537533.1
XM_011539232.1		Intron			XP_011537534.1
XM_011539233.1		Intron			XP_011537535.1
XM_017015634.1		Intron			XP_016871123.1
XM_017015635.1		Intron			XP_016871124.1

Gene: LINC00601
Gene Name: long intergenic non-protein coding RNA 601

There are no transcripts associated with this gene.

Gene: LOC728158
Gene Name: hCG2044975

There are no transcripts associated with this gene.

View Full Product Details